H2BC5 Human qPCR Primer Pair (NM_138720)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
HIST1H2BD (Myc-DDK-tagged)-Human histone cluster 1, H2bd (HIST1H2BD), transcript variant 2
USD 225.00
Other products for "H2BC5"
Specifications
Product Data | |
Gene ID | 3017 |
Forward Sequence | AGCCGCAAGGAGAGCTATTCAG |
Reverse Sequence | CGCTCGAAGATGTCGTTGACGA |
Accession No | NM_138720, NM_138720.1, NM_138720.2, BC002842, BC002842.2, BC096122, BE245851, BM153714 |
UniProt ID | P62807 |
Synonyms | dJ221C16.6; H2B.1B; H2B/a; H2B/b; H2B/g; H2B/h; H2B/k; H2B/l; H2BFA; H2BFB; H2BFG; H2BFH; H2BFK; H2BFL; HIRIP2; HIST1H2BC; HIST1H2BD; HIST1H2BE; HIST1H2BF; HIST1H2BG; HIST1H2BI |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.