NHP2L1 (SNU13) Human qPCR Primer Pair (NM_005008)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
NHP2L1 (Myc-DDK-tagged)-Human NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) (NHP2L1), transcript variant 1
USD 150.00
Rabbit polyclonal antibody to NHP2-like protein 1 (NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae))
USD 625.00
Other products for "SNU13"
Specifications
Product Data | |
Gene ID | 4809 |
Forward Sequence | TGGACCTCGTTCAGCAGTCATG |
Reverse Sequence | GGTGCAGAATGATCTCCAGTGG |
Accession No | NM_005008, NM_005008.1, NM_005008.2, NM_005008.3, BC095439, BC005358, BC019282, BG164621, BI770951, NM_005008.4 |
UniProt ID | P55769 |
Synonyms | 15.5K; FA-1; FA1; NHP2L1; NHPX; OTK27; SNRNP15-5; SPAG12; SSFA1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.