EEF1D Human qPCR Primer Pair (NM_032378)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
EEF1D (Myc-DDK-tagged)-Human eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) (EEF1D), transcript variant 2
USD 603.00
Other products for "EEF1D"
Specifications
Product Data | |
Gene ID | 1936 |
Forward Sequence | GGATTGCCAGTCTGGAAGTGGA |
Reverse Sequence | AGCTCTTCTCCAGCACGTTCAG |
Accession No | NM_032378, NM_032378.1, NM_032378.2, NM_032378.3, NM_032378.4, NM_032378.5, BC007847, BC000678, BC009907, BC012819, BC046445, BC062535, BC071840, BC094806, BG482145, BG748894, BI667117, BQ064320, BQ083927, BQ686171, BT007242, NM_032378.6 |
UniProt ID | P29692 |
Synonyms | EF-1D; EF1D; FP1047 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.