KCNMA1 Human qPCR Primer Pair (NM_002247)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
KCNMA1 (tGFP-tagged) - Human potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (KCNMA1), transcript variant 2
USD 1,738.00
Other products for "KCNMA1"
Specifications
Product Data | |
Gene ID | 3778 |
Forward Sequence | TATCTCTCCAGTGCCTTCGTGG |
Reverse Sequence | CTCTCTCGGTTGGCAGACTTGT |
Accession No | BC024965, NM_002247, NM_002247.1, NM_002247.2, NM_002247.3, BC009695, BC062659, BC137115, BC137137, BC144496, BQ574058, BX648925, NM_002247.4 |
UniProt ID | Q12791 |
Synonyms | bA205K10.1; BKTM; CADEDS; hSlo; IEG16; KCa1.1; LIWAS; MaxiK; mSLO1; PNKD3; SAKCA; SLO; SLO-ALPHA; SLO1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.