PDE9A Human qPCR Primer Pair (NM_002606)

CAT#: HP228330

qSTAR qPCR primer pairs against Homo sapiens gene PDE9A

USD 95.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 5152
Forward Sequence TCCGTCCAATGGAAGTCGCAGA
Reverse Sequence CCTTGGTCACTTTGTCTCGGTC
Accession No AK096468, NM_001001567, NM_001001568, NM_001001569, NM_001001570, NM_001001571, NM_001001572, NM_001001573, NM_001001574, NM_001001575, NM_001001576, NM_001001577, NM_001001578, NM_001001579, NM_001001580, NM_001001581, NM_001001582, NM_001001583, NM_001001584, NM_001001585, NM_001315533, NM_002606, XM_011529598, XM_011529600, XM_017028366, XM_017028367
Synonyms HSPDE9A2; HSPDE9A2
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents