IKK gamma (IKBKG) Human qPCR Primer Pair (NM_003639)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
IKBKG (Myc-DDK-tagged)-Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 3
USD 457.00
Other products for "IKBKG"
Specifications
Product Data | |
Gene ID | 8517 |
Forward Sequence | AGCACCTGAAGAGATGCCAGCA |
Reverse Sequence | AGCCTGGCATTCCTTAGTGGCA |
Accession No | NM_003639, NM_003639.1, NM_003639.2, NM_003639.3, NM_003639.4, BC000299, BC000299.2, BC050612, BC012114, BC046922, BM473416, BT019621 |
UniProt ID | Q9Y6K9 |
Synonyms | AMCBX1; EDAID1; FIP-3; FIP3; Fip3p; IKK-gamma; IKKAP1; IKKG; IMD33; IP; IP1; IP2; IPD2; NEMO; ZC2HC9 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.