Sumo 1 (SUMO1) Human qPCR Primer Pair (NM_003352)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
SUMO1 (Myc-DDK-tagged)-Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1
USD 150.00
Other products for "SUMO1"
Specifications
Product Data | |
Gene ID | 7341 |
Forward Sequence | AGCAGTGAGATTCACTTCAAAGTG |
Reverse Sequence | TCTGACCCTCAAAGAGAAACCTG |
Accession No | NM_003352, NM_003352.1, NM_003352.2, NM_003352.3, NM_003352.4, BC006462, BC006462.1, BC005899, BC053528, BC066306, BG503431, BG569821, BQ930026, BT006632, BU532734, NM_003352.8 |
UniProt ID | P63165 |
Synonyms | DAP1; GMP1; OFC10; PIC1; SENP2; SMT3; SMT3C; SMT3H3; UBL1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.