C22orf40 (CDPF1) Human qPCR Primer Pair (NM_207327)

CAT#: HP226632

qSTAR qPCR primer pairs against Homo sapiens gene CDPF1

Specifications

Product Data

• Gene ID: 150383
• Forward Sequence: TTCTCGGACGTGAGTGCAACTG
• Reverse Sequence: TGCTCCCAGTGGTCCAGAAACA
• Accession No: NM_207327, NM_207327.1, NM_207327.3, NM_207327.4, BC067871, BC067871.1, BC036462, BC045796, BX648331, NM_207327.5
• UniProt ID: Q6NVV7
• Synonyms: C22orf40
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.