SFRS5 (SRSF5) Human qPCR Primer Pair (NM_006925)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Lenti ORF particles, SRSF5 (Myc-DDK tagged) - Human serine/arginine-rich splicing factor 5 (SRSF5), transcript variant 2, 200ul, >10^7 TU/mL
USD 850.00
Other products for "SRSF5"
Specifications
Product Data | |
Gene ID | 6430 |
Forward Sequence | GGTGGTTGAGTTTGCCTCTTATG |
Reverse Sequence | GATCGAGACCTGCTTCTTGACC |
Accession No | BC029984, NM_006925, NM_006925.1, NM_006925.2, NM_006925.3, BC040209, BC040209.1, BC018823, BC095420, BF213008, BT007089, BU928782, BX247988, BX407495, BX640605, NM_006925.5 |
UniProt ID | Q13243 |
Synonyms | HRS; SFRS5; SRP40 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.