Estrogen Receptor beta (ESR2) Human qPCR Primer Pair (NM_001437)

CAT#: HP225829

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene ESR2

USD 120.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 2100
Forward Sequence ATGGAGTCTGGTCGTGTGAAGG
Reverse Sequence TAACACTTCCGAAGTCGGCAGG
Accession No NM_001040275, NM_001040276, NM_001214902, NM_001214903, NM_001271876, NM_001271877, NM_001291712, NM_001291723, NM_001437, NR_073496, NR_073497, NR_073505, BC024181, BX094834, BX247957
Synonyms ER-BETA; Erb; ESR-BETA; ESRB; ESTRB; NR3A2; ODG8
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "ESR2"
Frequently bought together (2)
ESR2 mouse monoclonal antibody,clone OTI1A5
    • 100 ul

USD 379.00


ESR2 (Myc-DDK-tagged)-Human estrogen receptor 2 (ER beta) (ESR2), transcript variant a
    • 10 ug

USD 480.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones