WNK1 Human qPCR Primer Pair (NM_213655)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
WNK1 (Myc-DDK-tagged)-Human WNK lysine deficient protein kinase 1 (WNK1), transcript variant 1
USD 1,966.00
Other products for "WNK1"
Specifications
Product Data | |
Gene ID | 65125 |
Forward Sequence | AGCTGCACCTTTTGGCTCTGAC |
Reverse Sequence | AGACCTGCTGAGATGTGGTTCC |
Accession No | BC021121, NM_213655, NM_213655.3, NM_213655.4, BC130467, BC013629, BC035146, BC044600, BC071959, BC094862, BC130469, BC141881, BC172444, BJ997509, BM716053, BX644268 |
UniProt ID | Q9H4A3 |
Synonyms | HSAN2; HSN2; KDP; p65; PPP1R167; PRKWNK1; PSK |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.