GPR180 Human qPCR Primer Pair (NM_180989)

CAT#: HP218930

qSTAR qPCR primer pairs against Homo sapiens gene GPR180

Specifications

Product Data

• Gene ID: 160897
• Forward Sequence: GATTCTACGCCTGCATCCACTG
• Reverse Sequence: GATCCCTGCTAAGTTGTGGTGTG
• Accession No: NM_180989, NM_180989.1, NM_180989.2, NM_180989.3, NM_180989.4, NM_180989.5, BC052243, BC052243.1, BC033906, BG112926, BI856811, BX348762
• UniProt ID: Q86V85
• Synonyms: ITR
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.