ST6GALNAC3 Human qPCR Primer Pair (NM_152996)
CAT#: HP218002
qSTAR qPCR primer pairs against Homo sapiens gene ST6GALNAC3
SensiMix SYBR Master Mix
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
ST6GALNAC3 (Myc-DDK-tagged)-Human ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 (ST6GALNAC3), transcript variant 1
USD 300.00
Other products for "ST6GALNAC3"
Specifications
Product Data | |
Gene ID | 256435 |
Forward Sequence | TACGTGACCACAGAGAAGCGCA |
Reverse Sequence | CGTGAATGCCATAACAGGCGTC |
Accession No | NM_152996, NM_152996.1, NM_152996.2, NM_152996.3, BC059363, BC039520, BX648274, NM_152996.4 |
UniProt ID | Q8NDV1 |
Synonyms | PRO7177; SIAT7C; ST6GALNACIII; STY |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.