DTD1 Human qPCR Primer Pair (NM_080820)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
DTD1 (Myc-DDK-tagged)-Human D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae) (DTD1), nuclear gene encoding mitochondrial protein
USD 300.00
Other products for "DTD1"
Specifications
Product Data | |
Gene ID | 92675 |
Forward Sequence | CTACAACAGCTTCCTGGAGCAG |
Reverse Sequence | TGGCGATTCCAGCTCTATGGTC |
Accession No | NM_080820, NM_080820.1, NM_080820.2, NM_080820.3, NM_080820.4, NM_080820.5, BC045167, BC045167.2, BC000599, BC100923, BC100924, BC100925, BC100926, BI159760, BI465352, BU729150, NM_080820.6 |
UniProt ID | Q8TEA8 |
Synonyms | C20orf88; DTD; DUE-B; DUEB; HARS2; pqn-68 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.