PWWP3A Human qPCR Primer Pair (NM_032853)

SKU HP216210

qSTAR qPCR primer pairs against Homo sapiens gene MUM1

Product Data

• Locus ID: 84939
• Forward Sequence: TGTGTCTCCCTCATCACCGACT
• Reverse Sequence: GCTGGATGGATTTTCGGACAGG
• ACCN: BD127600, NM_032853, NM_032853.1, NM_032853.2, NM_032853.3, BC110874, BC110874.1, BC001806, BC008098, BC019585, BC021016, BC082987, BC130443, BC144138, BC144147, BG723598, BI553935, BQ071619, BQ895780, BU541563, BU741593, NM_032853.5
• UniProt ID: Q2TAK8
• Synonyms: EXPAND1; HSPC211; MUM-1; MUM1
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient