Transmembrane Protein 175 (TMEM175) Human qPCR Primer Pair (NM_032326)

CAT#: HP215879

qSTAR qPCR primer pairs against Homo sapiens gene TMEM175

Specifications

Product Data

• Gene ID: 84286
• Forward Sequence: AGAGGCTTCTGGCAACACGGAT
• Reverse Sequence: AGGTTGAGCAGGGCAAGTGTGT
• Accession No: NM_032326, NM_032326.1, NM_032326.2, NM_032326.3, BC005158, BC047738, BC063488, BC095416, BC118552, BI819231
• UniProt ID: Q9BSA9
• Synonyms: hTMEM175
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.