FTHL17 Human qPCR Primer Pair (NM_031894)

CAT#: HP215641

qSTAR qPCR primer pairs against Homo sapiens gene FTHL17

USD 95.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 53940
Forward Sequence ACTTCCTGGAGAGCCACTACCT
Reverse Sequence GGTGAGCTTGTCGAACAGGTAC
Accession No NM_031894
Synonyms CT38
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents