RAMAC Human qPCR Primer Pair (NM_031452)

CAT#: HP215597

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene FAM103A1

USD 100.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 83640
Forward Sequence GTGGGAACCAAAGAAACAGAGGC
Reverse Sequence GGATCGTCCATGCCACTGATTG
Accession No NM_031452, BC003627, BC027181, BC112329, BQ002618
Synonyms C15orf18; FAM103A1; HsT19360; RAM; RAMMET
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "RAMAC"
Frequently bought together (1)
FAM103A1 (Myc-DDK-tagged)-Human family with sequence similarity 103, member A1 (FAM103A1)
    • 10 ug

USD 98.00 USD 390.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones