ADAM19 Human qPCR Primer Pair (NM_023038)

CAT#: HP214632

qSTAR qPCR primer pairs against Homo sapiens gene ADAM19

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 8728
Forward Sequence CGAGAAGGTGAATGTGGCAGGA
Reverse Sequence AGCTCTGACACTGGATCTTCCC
Accession No NM_023038, NM_033274, XM_005266003, XM_011534682, XM_017010009
Synonyms FKSG34; MADDAM; MLTNB; ADAM metallopeptidase domain 19; a disintegrin and metalloproteinase domain 19 (meltrin beta); meltrin beta; ADAM metallopeptidase domain 19 (meltrin beta)
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "ADAM19"
Frequently bought together (1)
Goat Anti-ADAM19 Antibody
    • 100 ug

USD 360.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones