XPNPEP3 Human qPCR Primer Pair (NM_022098)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
XPNPEP3 (Myc-DDK-tagged)-Human X-prolyl aminopeptidase (aminopeptidase P) 3, putative (XPNPEP3), nuclear gene encoding mitochondrial protein, transcript variant 1
USD 472.00
Other products for "XPNPEP3"
Specifications
Product Data | |
Gene ID | 63929 |
Forward Sequence | GGATGGAGGTTGTGAGTCTTCC |
Reverse Sequence | CGGCTTCATAGAGTTCTGCCTG |
Accession No | BC001208, NM_022098, NM_022098.1, NM_022098.2, NM_022098.3, BC001208.1, BC001681, BC004989, BC005331, BC011632, BC016735, BC023654, BC032537, BC037424, BC045166, BC053556, BM980889, BP346902, BX648018, NM_022098.4 |
UniProt ID | Q9NQH7 |
Synonyms | APP3; ICP55; NPHPL1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.