GAN Human qPCR Primer Pair (NM_022041)

CAT#: HP214310

qSTAR qPCR primer pairs against Homo sapiens gene GAN

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 8139
Forward Sequence GGCTACTCTGAGTGCATCGTGA
Reverse Sequence CCAGTTCGATCCAAAGCTGCCT
Accession No NM_022041, XM_017023734
Synonyms GAN1; KLHL16
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
Frequently bought together (2)
Rabbit Polyclonal Anti-GAN Antibody - middle region
    • 100 ul

USD 360.00


GAN (Myc-DDK-tagged)-Human gigaxonin (GAN)
    • 10 ug

USD 410.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones