CDH19 Human qPCR Primer Pair (NM_021153)

CAT#: HP214084

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene CDH19

USD 100.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 28513
Forward Sequence ATTGGTCAGCCAGGAGCGTTGT
Reverse Sequence GCAGATTCAGAGACAGTCAAGCG
Accession No NM_001271028, NM_021153, NR_073130, XM_011525931, XM_011525932, XM_017025711
Synonyms CDH7; CDH7L2
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "CDH19"
Frequently bought together (2)
Rabbit polyclonal anti-CDH19 antibody
    • 100 ul

USD 335.00


CDH19 (Myc-DDK-tagged)-Human cadherin 19, type 2 (CDH19)
    • 10 ug

USD 600.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones