CHD8 Human qPCR Primer Pair (NM_020920)

CAT#: HP213928

qSTAR qPCR primer pairs against Homo sapiens gene CHD8

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 57680
Forward Sequence CACTGACTGCTTTCGGGTGGAA
Reverse Sequence GGTCTCCACATCTCGTTCAGTC
Accession No NM_001170629, NM_020920, XM_033511, XM_370738
Synonyms AUTS18; HELSNF1
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
Other products for "CHD8"
Frequently bought together (1)
CHD8 (Myc-DDK-tagged)-Human chromodomain helicase DNA binding protein 8 (CHD8), transcript variant 2
    • 10 ug

USD 1,999.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones