SLC12A5 Human qPCR Primer Pair (NM_020708)

CAT#: HP213779

qSTAR qPCR primer pairs against Homo sapiens gene SLC12A5

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 57468
Forward Sequence TGGCACTCCTATCGACATGGAC
Reverse Sequence AGAGCGGTTAGAACCAGCCATG
Accession No NM_001134771, NM_020708, XM_017027981
Synonyms EIEE34; EIG14; hKCC2; KCC2
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
Other products for "SLC12A5"
Frequently bought together (2)
Rabbit Polyclonal Anti-Slc12a5 Antibody
    • 100 ul

USD 360.00


SLC12A5 (Myc-DDK-tagged)-Human solute carrier family 12 (potassium/chloride transporter), member 5 (SLC12A5), transcript variant 2
    • 10 ug

USD 610.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones