FAM20C Human qPCR Primer Pair (NM_020223)

CAT#: HP213569

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene FAM20C


USD 120.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 56975
Forward Sequence CTGACTACTGCGAGGAGGTGAA
Reverse Sequence TCTCGTAGTGGTGACGGTCCAT
Accession No BC040074, NM_020223, BC009531, BC068086, BC087853, BQ026938
Synonyms DMP-4; DMP4; G-CK; GEF-CK; RNS
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "FAM20C"
Frequently bought together (4)
Rabbit Polyclonal Anti-FAM20C Antibody
    • 100 ul

USD 375.00


FAM20C (Myc-DDK-tagged)-Human family with sequence similarity 20, member C (FAM20C)
    • 10 ug

USD 480.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 140.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 440.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools