FAM20C Human qPCR Primer Pair (NM_020223)

CAT#: HP213569

qSTAR qPCR primer pairs against Homo sapiens gene FAM20C

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 56975
Forward Sequence CTGACTACTGCGAGGAGGTGAA
Reverse Sequence TCTCGTAGTGGTGACGGTCCAT
Accession No AK054704, BC040074, NM_020223, XM_017012450, XM_017012451, XM_017012452, XM_017012453, XM_017012454, XM_017012455, XM_098621, XM_371863, XM_928334, XR_001744837, XR_242097
Synonyms DMP-4; DMP4; G-CK; GEF-CK; RNS
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "FAM20C"
Frequently bought together (2)
Rabbit Polyclonal Anti-FAM20C Antibody
    • 100 ul

USD 360.00


FAM20C (Myc-DDK-tagged)-Human family with sequence similarity 20, member C (FAM20C)
    • 10 ug

USD 590.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones