TM9SF3 Human qPCR Primer Pair (NM_020123)

CAT#: HP213494

qSTAR qPCR primer pairs against Homo sapiens gene TM9SF3

USD 95.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 56889
Forward Sequence TGCTTCAAGAGCCATTCCTTTTGG
Reverse Sequence CACGACAAGGAAAGTTGGGCTG
Accession No NM_020123, XM_011539976, XM_011539977
Synonyms EP70-P-iso; SMBP
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents