PARD3 Human qPCR Primer Pair (NM_019619)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Lenti ORF particles, PARD3 (Myc-DDK tagged) - Human par-3 partitioning defective 3 homolog (C. elegans) (PARD3), transcript variant 1, 200ul, >10^7 TU/mL
USD 1,710.00
Other products for "PARD3"
Specifications
Product Data | |
Gene ID | 56288 |
Forward Sequence | CGGTCAAAAGAGAACCACGCAG |
Reverse Sequence | CATTCACCCGAAGCCTTCCATC |
Accession No | NM_019619, NM_019619.1, NM_019619.2, NM_019619.3, BC071566, BC011711, BE464617, BM796605 |
UniProt ID | Q8TEW0 |
Synonyms | ASIP; Baz; PAR3; PAR3alpha; PARD-3; PARD3A; PPP1R118; SE2-5L16; SE2-5LT1; SE2-5T2 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.