SLC30A6 Human qPCR Primer Pair (NM_017964)

CAT#: HP212734

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene SLC30A6

USD 100.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 55676
Forward Sequence TCCTGGCTGTATTTGCCTCCAC
Reverse Sequence GAACAGGTTGAAACAAAGAGCCAC
Accession No NM_001193513, NM_001193514, NM_001193515, NM_001330476, NM_001330477, NM_001330478, NM_001330479, NM_017964, XM_006712048, XM_011532959, XM_011532962, XM_011532963, XM_017004462, XM_017004463, XM_017004464, XM_017004465, XM_017004466
Synonyms MST103; MSTP103; ZNT6
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "SLC30A6"
Frequently bought together (2)
Anti-SLC30A6 Rabbit Polyclonal Antibody
    • 100 ul

USD 335.00


SLC30A6 (Myc-DDK-tagged)-Human solute carrier family 30 (zinc transporter), member 6 (SLC30A6), transcript variant 2
    • 10 ug

USD 410.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones