Cytochrome P450 3A4 (CYP3A4) Human qPCR Primer Pair (NM_017460)
USD 142.00
2 Weeks*
Size
Product Images
Frequently bought together (4)
CYP3A4 (Myc-DDK-tagged)-Human cytochrome P450, family 3, subfamily A, polypeptide 4 (CYP3A4), transcript variant 1
USD 702.00
Other products for "CYP3A4"
Specifications
Product Data | |
Gene ID | 1576 |
Forward Sequence | CCGAGTGGATTTCCTTCAGCTG |
Reverse Sequence | TGCTCGTGGTTTCATAGCCAGC |
Accession No | NM_017460, NM_017460.1, NM_017460.2, NM_017460.3, NM_017460.4, NM_017460.5, BC069418, BC069418.1, BC069352, BC101631, NM_017460.6 |
UniProt ID | P08684 |
Synonyms | CP33; CP34; CYP3A; CYP3A3; CYPIIIA3; CYPIIIA4; HLP; NF-25; P450C3; P450PCN1; VDDR3 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.