COPZ1 Human qPCR Primer Pair (NM_016057)

CAT#: HP211944

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene COPZ1


USD 120.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 22818
Forward Sequence GGCTGTTCTGAACTGTCTCTTCG
Reverse Sequence TCATCCACAGCCAAGAACAGCC
Accession No NM_001271734, NM_001271735, NM_001271736, NM_016057, NR_073424, BC002849
Synonyms CGI-120; COPZ; HSPC181; zeta-COP; zeta1-COP
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "COPZ1"
Frequently bought together (7)
Rabbit polyclonal anti-COPZ1 antibody
    • 100 ul

USD 345.00


COPZ1 (Myc-DDK tagged) - Homo sapiens coatomer protein complex, subunit zeta 1 (COPZ1), transcript variant 2
    • 10 ug

USD 420.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 140.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 440.00


COPZ1 (Myc-DDK tagged) - Homo sapiens coatomer protein complex, subunit zeta 1 (COPZ1), transcript variant 3
    • 10 ug

USD 420.00


COPZ1 (Myc-DDK tagged) - Homo sapiens coatomer protein complex, subunit zeta 1 (COPZ1), transcript variant 4
    • 10 ug

USD 420.00


COPZ1 (Myc-DDK-tagged)-Human coatomer protein complex, subunit zeta 1 (COPZ1)
    • 10 ug

USD 98.00 USD 390.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools