RSL1D1 Human qPCR Primer Pair (NM_015659)

CAT#: HP211756

qSTAR qPCR primer pairs against Homo sapiens gene RSL1D1

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 26156
Forward Sequence TCCGAAGACGAAATCCCACAGC
Reverse Sequence GTGCTGGGATTAGGACTCTTTGC
Accession No NM_015659
Synonyms CSIG; L12; PBK1; UTP30
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
Other products for "RSL1D1"
Frequently bought together (2)
Rabbit polyclonal anti-PBK1 antibody
    • 100 ug

USD 515.00


RSL1D1 (Myc-DDK-tagged)-Human ribosomal L1 domain containing 1 (RSL1D1)
    • 10 ug

USD 410.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones