TTC9 Human qPCR Primer Pair (NM_015351)

CAT#: HP211572

qSTAR qPCR primer pairs against Homo sapiens gene TTC9

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 23508
Forward Sequence GGGAGAACTTCAAGGCCCTTTAC
Reverse Sequence TCGGCTGAGTTTCATCTCCGTC
Accession No NM_015351, XM_027236, XM_938197
Synonyms TTC9A; TTC9A
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C

Documents

Other products for "TTC9"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies