SASH1 Human qPCR Primer Pair (NM_015278)

CAT#: HP211516

qSTAR qPCR primer pairs against Homo sapiens gene SASH1



SensiMix SYBR Master Mix

USD 142.00

5 Days*

Size
    • 200 reactions

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-SASH1 Antibody
    • 100 ul

USD 380.00


SASH1 (Myc-DDK-tagged)-Human SAM and SH3 domain containing 1 (SASH1)
    • 10 ug

USD 1,085.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 165.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00

Other products for "SASH1"

Specifications

Product Data
Gene ID 23328
Forward Sequence GTAACAGCGACCAGTCAGGATC
Reverse Sequence GACTTGGCAGATAGGAGGCTAG
Accession No NM_015278, NM_015278.1, NM_015278.2, NM_015278.3, NM_015278.4, BC028303, BC063279, BN000088, BX537611, NM_015278.5
UniProt ID O94885
Synonyms CAPOK; dJ323M4.1; DUH1; SH3D6A
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.