GOLGA8A Human qPCR Primer Pair (NM_015003)

CAT#: HP211317

qSTAR qPCR primer pairs against Homo sapiens gene GOLGIN-67

Specifications

Product Data

• Gene ID: 23015
• Forward Sequence: CATCGCCTTCTAACAGAGCCAG
• Reverse Sequence: ACAAGCCGCAACACCATCTCCT
• Accession No: NM_015003, BC093673, BC093673.1, BC032774, BC064341, BC104800, BC144609, BC150329, BC152410, BX648160, BX648575
• UniProt ID: A7E2F4
• Synonyms: GM88
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.