CEP104 Human qPCR Primer Pair (NM_014704)

CAT#: HP211085

qSTAR qPCR primer pairs against Homo sapiens gene CEP104

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 9731
Forward Sequence CACCTGGCAATGAGTCAGATGG
Reverse Sequence GCGGACCTCATACACTCTATGC
Accession No NM_014704, XM_005244815, XM_011542473, XM_011542474, XM_011542475, XM_011542476, XM_011542477, XM_011542478, XM_017002917, XM_017002918, XM_017002919, XM_375682
Synonyms CFAP256; GlyBP; JBTS25; KIAA0562; ROC22
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
Other products for "CEP104"
Frequently bought together (2)
Rabbit Polyclonal Anti-CEP104 Antibody
    • 100 ul

USD 360.00


CEP104 (Myc-DDK-tagged)-Human centrosomal protein 104kDa (CEP104)
    • 10 ug

USD 720.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies