ATP11B Human qPCR Primer Pair (NM_014616)

CAT#: HP211013

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene ATP11B

USD 100.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 23200
Forward Sequence GAATGCCAGCAACCAGAAGCAG
Reverse Sequence AATCTGGCTCCACGAAGCAGGA
Accession No AF156548, BC033880, NM_014616, XM_005247241, XM_005247243, XM_011512593, XM_011512594, XM_011512597, XM_017006008, XM_017006009, XM_087254, XR_001740066, XR_001740067, XR_001740068
Synonyms ATPIF; ATPIR
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "ATP11B"
Frequently bought together (2)
Rabbit Polyclonal ATP11B Antibody
    • 100 ug

USD 415.00


ATP11B (Myc-DDK-tagged)-Human ATPase, class VI, type 11B (ATP11B)
    • 10 ug

USD 1,240.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones