ALDH1L1 Human qPCR Primer Pair (NM_012190)

CAT#: HP210177

qSTAR qPCR primer pairs against Homo sapiens gene ALDH1L1

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 10840
Forward Sequence GGATGCCTTTGAGAATGGACGG
Reverse Sequence TCCTGGTGCTGCTCCATGAGAT
Accession No NM_001270364, NM_001270365, NM_012190, NM_144776, NR_072979, XM_006713481, XM_011512355, XM_017005613, XM_017005614
Synonyms 10-fTHF; 10-FTHFDH; FDH; FTHFD
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
Other products for "ALDH1L1"
Frequently bought together (2)
ALDH1L1 mouse monoclonal antibody, clone OTI2A6 (formerly 2A6)
    • 100 ul

USD 379.00


ALDH1L1 (Myc-DDK-tagged)-Human aldehyde dehydrogenase 1 family, member L1 (ALDH1L1)
    • 10 ug

USD 520.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones