HSP90AB1 Human qPCR Primer Pair (NM_007355)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
HSP90AB1 (Myc-DDK-tagged)-Human heat shock protein 90kDa alpha (cytosolic), class B member 1 (HSP90AB1)
USD 994.00
Mouse monoclonal anti-HSP90AB1(HSP90) antibody, clone 4C10, Load, clone OTI4C10 (formerly 4C10)
USD 478.00
Other products for "HSP90AB1"
Specifications
Product Data | |
Gene ID | 3326 |
Forward Sequence | CTCTGTCAGAGTATGTTTCTCGC |
Reverse Sequence | GTTTCCGCACTCGCTCCACAAA |
Accession No | NM_007355, NM_007355.1, NM_007355.2, NM_007355.3, BC012807, BC012807.2, BC004928, BC007327, BC009206, BC014485, BC016753, BC068474, BE539681, BG482327, BI252490, BQ028821, BX420114, BX649079, NM_007355.4 |
UniProt ID | P08238 |
Synonyms | D6S182; HSP84; HSP90B; HSPC2; HSPCB |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.