ALF (GTF2A1L) Human qPCR Primer Pair (NM_006872)

CAT#: HP209735

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene GTF2A1L


USD 120.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 11036
Forward Sequence CCTGCTGGTAGAACTCTTCCAAG
Reverse Sequence GTGTCACACCTGCTGGTACATG
Accession No NM_001193487, NM_006872, NM_172196, BC025991, BC064585, BG207854, BG717289
Synonyms ALF
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "GTF2A1L"
Frequently bought together (5)
GTF2A1L mouse monoclonal antibody,clone OTI1D3
    • 100 ul

USD 379.00


GTF2A1L (Myc-DDK-tagged)-Human general transcription factor IIA, 1-like (GTF2A1L), transcript variant 2
    • 10 ug

USD 420.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 140.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 440.00


GTF2A1L (Myc-DDK-tagged)-Human general transcription factor IIA, 1-like (GTF2A1L), transcript variant 1
    • 10 ug

USD 420.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools