AKAP13 Human qPCR Primer Pair (NM_006738)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
AKAP13 (Myc-DDK-tagged)-Human A kinase (PRKA) anchor protein 13 (AKAP13), transcript variant 1
USD 2,282.00
Other products for "AKAP13"
Specifications
Product Data | |
Gene ID | 11214 |
Forward Sequence | GAAGTGGCTGTAGGGAGCATAG |
Reverse Sequence | TGGAAGCCAGAAGAGATGCTGC |
Accession No | NM_006738, NM_006738.3, NM_006738.4, NM_006738.5, BC000269, BC009213, BC017368, BC019662, BC040109, BC050312, BC063592, BC089394, BC140862, BC171798, BC172356, NM_006738.6 |
UniProt ID | Q12802 |
Synonyms | AKAP-13; AKAP-Lbc; ARHGEF13; BRX; c-lbc; HA-3; Ht31; LBC; p47; PRKA13; PROTO-LB; PROTO-LBC |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.