RAMP1 Human qPCR Primer Pair (NM_005855)

CAT#: HP208914

qSTAR qPCR primer pairs against Homo sapiens gene RAMP1

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 10267
Forward Sequence CTCACCCAGTTCCAGGTAGACA
Reverse Sequence CAGGAAGAACCTGTCCACCTCT
Accession No NM_005855, XM_017003152, XM_017003153, XM_017003154, XM_017003155, XM_017003156
Synonyms receptor (calcitonin) activity modifying protein 1; receptor-activity modifying protein 1; receptor (G protein-coupled) activity modifying protein 1
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
Other products for "RAMP1"
Frequently bought together (2)
Anti-RAMP1 Rabbit Polyclonal Antibody
    • 100 ul

USD 335.00


RAMP1 (Myc-DDK-tagged)-Human receptor (G protein-coupled) activity modifying protein 1 (RAMP1)
    • 10 ug

USD 98.00 USD 390.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies