USH1C Human qPCR Primer Pair (NM_005709)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Lenti ORF particles, USH1C (mGFP-tagged) - Human Usher syndrome 1C (autosomal recessive, severe) (USH1C), transcript variant b3, 200ul, >10^7 TU/mL
USD 1,373.00
Other products for "USH1C"
Specifications
Product Data | |
Gene ID | 10083 |
Forward Sequence | TGTCTGCTGAGGTGGGATTGGA |
Reverse Sequence | CTGCGGCTACTCTTCAGCACAT |
Accession No | NM_005709, NM_005709.1, NM_005709.2, NM_005709.3, BC016057, BK000147, BX641129, NM_005709.4 |
UniProt ID | Q9Y6N9 |
Synonyms | AIE-75; DFNB18; DFNB18A; NY-CO-37; NY-CO-38; PDZ-45; PDZ-73; PDZ-73/NY-CO-38; PDZ73; PDZD7C; ush1cpst |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.