TMPRSS2 Human qPCR Primer Pair (NM_005656)

CAT#: HP208758

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene TMPRSS2



SensiMix SYBR Master Mix

USD 132.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 7113
Forward Sequence CCTCTAACTGGTGTGATGGCGT
Reverse Sequence TGCCAGGACTTCCTCTGAGATG
Accession No NM_001135099, NM_005656, NM_005656.1, NM_005656.2, NM_005656.3, NM_001135099.1, BC051839, BC051839.1, BC015819, BC035623, BP276431, NM_005656.4
UniProt ID O15393
Synonyms PRSS10
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "TMPRSS2"
Frequently bought together (5)
TMPRSS2 rabbit polyclonal antibody
    • 100 ul

USD 380.00


TMPRSS2 (Myc-DDK-tagged)-Human transmembrane protease, serine 2 (TMPRSS2), transcript variant 1
    • 10 ug

USD 544.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 154.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 484.00


TMPRSS2 (Myc-DDK-tagged)-Human transmembrane protease, serine 2 (TMPRSS2), transcript variant 2
    • 10 ug

USD 477.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.