TMPRSS2 Human qPCR Primer Pair (NM_005656)

CAT#: HP208758

qSTAR qPCR primer pairs against Homo sapiens gene TMPRSS2

Specifications

Product Data

• Gene ID: 7113
• Forward Sequence: CCTCTAACTGGTGTGATGGCGT
• Reverse Sequence: TGCCAGGACTTCCTCTGAGATG
• Accession No: NM_001135099, NM_005656, NM_005656.1, NM_005656.2, NM_005656.3, NM_001135099.1, BC051839, BC051839.1, BC015819, BC035623, BP276431, NM_005656.4
• UniProt ID: O15393
• Synonyms: PRSS10
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: The primer mix is stable for one year from date of shipping. Store at -20°C.