LGALS3BP Human qPCR Primer Pair (NM_005567)

CAT#: HP208684

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene LGALS3BP



USD 120.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 3959
Forward Sequence GGCAGCAATGTCACCATGAGTG
Reverse Sequence GTGGAAGCACTTGACTGACGAC
Accession No NM_005567, BC015761, BC002403, BC002998, BQ649131
Synonyms 90K; BTBD17B; CyCAP; gp90; M2BP; MAC-2-BP; TANGO10B
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "LGALS3BP"
Frequently bought together (4)
LGALS3BP mouse monoclonal antibody, clone OTI3G8 (formerly 3G8)
    • 100 ul

USD 379.00


LGALS3BP (Myc-DDK-tagged)-Human lectin, galactoside-binding, soluble, 3 binding protein (LGALS3BP)
    • 10 ug

USD 480.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 140.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 440.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools