Germany
Japan
United Kingdom
China
ASCL2 Human qPCR Primer Pair (NM_005170)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Other products for "ASCL2"
Specifications
| Product Data | |
| Gene ID | 430 |
| Forward Sequence | CGCCTACTCGTCGGACGACAG |
| Reverse Sequence | GCCGCTCGCTCGGCTTCCG |
| Accession No | NM_005170, NM_005170.1, NM_005170.2, BC057801, BC057801.1, BC028140, BC136561, BC136567 |
| UniProt ID | Q99929 |
| Synonyms | ASH2; bHLHa45; HASH2; MASH2 |
| Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.