SLC22A14 Human qPCR Primer Pair (NM_004803)

CAT#: HP208066

1 star1 star1 star1 star1 star Reviews (1)

qSTAR qPCR primer pairs against Homo sapiens gene SLC22A14



SensiMix SYBR Master Mix

USD 142.00

5 Days*

Size
    • 200 reactions

Product Images

Frequently bought together (4)
First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 165.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00


Rabbit Polyclonal Anti-SLC22A14 Antibody
    • 100 ul

USD 539.00


SLC22A14 (tGFP-tagged) - Human solute carrier family 22, member 14 (SLC22A14)
    • 10 ug

USD 1,029.00

Other products for "SLC22A14"

Specifications

Product Data
Gene ID 9389
Forward Sequence TTCGCTTTGGCATCTCGCAGTC
Reverse Sequence TGTAGGCGATCCCTGTCAGCAA
Accession No NM_004803, NM_004803.1, NM_004803.2, NM_004803.3, NM_004803.4, BC075070, BC075071, BC126482, BC130543, BC144079
UniProt ID Q9Y267
Synonyms OCTL2; OCTL4; ORCTL4
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

{0} Product Review(s)

1 Product Review(s) 1 star1 star1 star1 star1 star Submit review

1 star1 star1 star1 star1 star

Used for gene expression studies.

Anjan P. on 04/04/2023

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.