BCL7C Human qPCR Primer Pair (NM_004765)

CAT#: HP208032

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene BCL7C

USD 100.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 9274
Forward Sequence AGGAGCCTGTTCCAGAACTGCT
Reverse Sequence CATTTGGGCAGATGCGCTTGAG
Accession No NM_001286526, NM_004765, XM_011545980, XM_017023885, XM_017023886, XM_017023887, XM_017023888
Synonyms B-cell CLL/lymphoma 7C
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "BCL7C"
Frequently bought together (2)
Rabbit Polyclonal BCL7C Antibody
    • 100 ul

USD 285.00


BCL7C (Myc-DDK-tagged)-Human B-cell CLL/lymphoma 7C (BCL7C)
    • 10 ug

USD 98.00 USD 390.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones