NAIP Human qPCR Primer Pair (NM_004536)

CAT#: HP207831

qSTAR qPCR primer pairs against Homo sapiens gene NAIP

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 4671
Forward Sequence CCGAACAGGAACTGCTTCTCAC
Reverse Sequence CCACAGACAGTTCTTTCAGGCAC
Accession No NM_004536, NM_022892, XM_011543413, XM_017009490
Synonyms BIRC1; NLRB1; psiNAIP
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
Other products for "NAIP"
Frequently bought together (2)
Rabbit Polyclonal NAIP Antibody
    • 100 ug

USD 409.00


NAIP (Myc-DDK-tagged)-Human NLR family, apoptosis inhibitory protein (NAIP), transcript variant 1
    • 10 ug

USD 850.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies