14-3-3 zeta (YWHAZ) Human qPCR Primer Pair (NM_003406)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
YWHAZ (Myc-DDK-tagged)-Human tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ), transcript variant 1
USD 300.00
Other products for "YWHAZ"
Specifications
Product Data | |
Gene ID | 7534 |
Forward Sequence | ACCGTTACTTGGCTGAGGTTGC |
Reverse Sequence | CCCAGTCTGATAGGATGTGTTGG |
Accession No | NM_003406, NM_003406.1, NM_003406.2, NM_003406.3, BC072426, BC072426.1, BC003623, BC013265, BC051814, BC063824, BC068456, BC070389, BC073141, BC083508, BC099904, BC101483, BC108281, BC111951, BM783874, BQ605329, NM_003406.4 |
UniProt ID | P63104 |
Synonyms | 14-3-3-zeta; HEL-S-3; HEL-S-93; HEL4; KCIP-1; POPCHAS; YWHAD |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.