Syntrophin alpha 1 (SNTA1) Human qPCR Primer Pair (NM_003098)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
SNTA1 (Syntrophin alpha 1) mouse monoclonal antibody, clone OTI1H10 (formerly 1H10)
USD 447.00
SNTA1 (Myc-DDK-tagged)-Human syntrophin, alpha 1 (dystrophin-associated protein A1, 59kDa, acidic component) (SNTA1)
USD 470.00
Other products for "SNTA1"
Specifications
Product Data | |
Gene ID | 6640 |
Forward Sequence | CCAGGACATCAAGCAGATTGGC |
Reverse Sequence | GAGACAAGTAGAGGAGCAGTTCC |
Accession No | NM_003098, NM_003098.1, NM_003098.2, BC026215, BC026215.2, BC113813, NM_003098.3 |
UniProt ID | Q13424 |
Synonyms | dJ1187J4.5; LQT12; SNT1; TACIP1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.